|
ATCC
organisms arthrobacter sp ![]() Organisms Arthrobacter Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/organisms arthrobacter sp/product/ATCC Average 93 stars, based on 1 article reviews
organisms arthrobacter sp - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
DSMZ
ca205 ![]() Ca205, supplied by DSMZ, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ca205/product/DSMZ Average 93 stars, based on 1 article reviews
ca205 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
DSMZ
paenarthrobacter ilicis dsmz 20138 ![]() Paenarthrobacter Ilicis Dsmz 20138, supplied by DSMZ, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paenarthrobacter ilicis dsmz 20138/product/DSMZ Average 93 stars, based on 1 article reviews
paenarthrobacter ilicis dsmz 20138 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
ATCC
dsm ![]() Dsm, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dsm/product/ATCC Average 93 stars, based on 1 article reviews
dsm - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
ATCC
type strain dsm ![]() Type Strain Dsm, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/type strain dsm/product/ATCC Average 93 stars, based on 1 article reviews
type strain dsm - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Proteintech
1 ap proteintech exd1 rabbit polyclonal ![]() 1 Ap Proteintech Exd1 Rabbit Polyclonal, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1 ap proteintech exd1 rabbit polyclonal/product/Proteintech Average 93 stars, based on 1 article reviews
1 ap proteintech exd1 rabbit polyclonal - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Proteintech
exd2 rabbit polyclonal ![]() Exd2 Rabbit Polyclonal, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/exd2 rabbit polyclonal/product/Proteintech Average 91 stars, based on 1 article reviews
exd2 rabbit polyclonal - by Bioz Stars,
2026-02
91/100 stars
|
Buy from Supplier |
|
Addgene inc
20138 n a recombinant dna gfp parp7 rodriguez ![]() 20138 N A Recombinant Dna Gfp Parp7 Rodriguez, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/20138 n a recombinant dna gfp parp7 rodriguez/product/Addgene inc Average 93 stars, based on 1 article reviews
20138 n a recombinant dna gfp parp7 rodriguez - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
ATCC
ttgtaccgcagctgcaaaat 30 macpherson ![]() Ttgtaccgcagctgcaaaat 30 Macpherson, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ttgtaccgcagctgcaaaat 30 macpherson/product/ATCC Average 93 stars, based on 1 article reviews
ttgtaccgcagctgcaaaat 30 macpherson - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
Journal: bioRxiv
Article Title: Comparative genome analysis of tea rhizosphere dwelling Paenarthrobacter nicotinovorans AB444: Uncovering Physiological Resilience and Ecological Adaptability
doi: 10.1101/2025.09.01.673609
Figure Lengend Snippet: Arrangement of mycelium studied by phase contrast microscopy. Phase contrast micrographs of actinomycets Paenarthrobacter sp. Cells were found as rod-shaped with some cell forming v-shaped arrangement. They were found to be motile in nature.
Article Snippet: The Venn diagram in ( ) also demonstrates the overlapping genetic features between the reference organism Paenarthrobacter AB444 (Query organism) and other organisms ( Arthrobacter agilis strain UMCV2, Arthrobacter bambusae DP-A9, Arthrobacter koreensis 5J12A, Arthrobacter ramosus ZX_2022b, Arthrobacter sp. AFG20, Arthrobacter sp. AFG7.2, Arthrobacter sp.
Techniques: Microscopy
Journal: bioRxiv
Article Title: Comparative genome analysis of tea rhizosphere dwelling Paenarthrobacter nicotinovorans AB444: Uncovering Physiological Resilience and Ecological Adaptability
doi: 10.1101/2025.09.01.673609
Figure Lengend Snippet:
Article Snippet: The Venn diagram in ( ) also demonstrates the overlapping genetic features between the reference organism Paenarthrobacter AB444 (Query organism) and other organisms ( Arthrobacter agilis strain UMCV2, Arthrobacter bambusae DP-A9, Arthrobacter koreensis 5J12A, Arthrobacter ramosus ZX_2022b, Arthrobacter sp. AFG20, Arthrobacter sp. AFG7.2, Arthrobacter sp.
Techniques:
Journal: bioRxiv
Article Title: Comparative genome analysis of tea rhizosphere dwelling Paenarthrobacter nicotinovorans AB444: Uncovering Physiological Resilience and Ecological Adaptability
doi: 10.1101/2025.09.01.673609
Figure Lengend Snippet: (a): A dendrogram plot is included to visualize the hierarchical clustering between the groups based on the biosynthetic genes, (b): VIP plot discriminating among the Paenarthrobacter sp , Pseudarthrobacter sp and Arthrobacter sp , (c): Venn Diagram of overlapping genetic features between reference and other selected organisms.
Article Snippet: The Venn diagram in ( ) also demonstrates the overlapping genetic features between the reference organism Paenarthrobacter AB444 (Query organism) and other organisms ( Arthrobacter agilis strain UMCV2, Arthrobacter bambusae DP-A9, Arthrobacter koreensis 5J12A, Arthrobacter ramosus ZX_2022b, Arthrobacter sp. AFG20, Arthrobacter sp. AFG7.2, Arthrobacter sp.
Techniques:
Journal: Heliyon
Article Title: Diversity and functional assessment of indigenous culturable bacteria inhabiting fine-flavor cacao rhizosphere: Uncovering antagonistic potential against Moniliophthora roreri
doi: 10.1016/j.heliyon.2024.e28453
Figure Lengend Snippet: Native culturable bacterial isolates and functional characterization.
Article Snippet: For example, only the strain IA201 was located in a single clade with Sphingobium scionense WP01 and S. yanoikuyae GIFU 9882 at 100% of bootstrap, CB304 was found with Lysobacter cavernae YIM C01544 and L. tabacisoli C8 1 at 99% of bootstrap,
Techniques: Functional Assay